Analogy/Homology Blog Post

Homologus traits:

For my species that posses homologus traits I chose whales and humans and their arms and fins. The bones in both the human hand and arm are similar to the bones that are in the fin of a whale. We humans have five fingers and even though we cannot see them, whales have five “finger” bones as well. In addition to those finger bones, both whales and humans have a humerus, a radius, and an ulna. Humans use their hands and fingers to help us function on dry land. Whales are in the water so they do not need fingers like humans do. Their fins function for their environment; if they had fingers underwater it would slow them down. The common ancestor between these two species would be the first tetrapod, which scientists believe lived 350 million years ago. It is believed that in addition to humans and whales, lizards and birds are also descendants of this one common ancestor.

Photo Courtesy of: World Wildlife Organization

 
 Photo Courtesy of Pace University

Analogous traits:

Two different species that possess analogous traits are dolphins and sharks. Both are animals who live in the ocean and have similar features, such as fins, body shape, however many of their features are analogous and not homologus. They both have fins and swim instead of live on land. One of their similarities to the naked eye is their shape. Both animals have a similar shape, however sharks do not have bones rather, they have cartilage. Dolphins on the other hand have bones. It would seem that both animals would have similar skeletons not only because they look similar but, they share the same environment.  It is possible that back in time somewhere these two animals did share a common ancestor. However, dolphins are mammals and sharks are not. This is a major difference between the two species.  Since they are not of the same family we know that the traits have evolved over long periods of time.

 

Photo Courtesy of: National Geographic Your Voice

 

Photo Courtesy of: BBC

Sources used:

http://www.bbc.co.uk/nature/life/Atlantic_spotted_dolphin

http://evolution.berkeley.edu/evolibrary/article/0_0_answer=b/similarity_hs_09

http://www.pace.edu/human-resources/

http://voices.nationalgeographic.com/2014/03/21/weird-animals-questions-science-animals-sharks/

http://www.worldwildlife.org/species/whale

Week 2: Protein Synthesis

Here is my DNA code for this week's blog post:

CGATTACACCCTGTCAGATCTTAAGTGAACATCTATCATTGC

Historical Influences on Darwin

Charles Darwin and his theory of Natural Selection is still something that we use in science today. As we have learned, Darwin used his hypothesis to prove how evolution happens. Through his own observation and thoughts as well as influence from several other men, including his grandfather, Charles Darwin was able to provide sufficient evidence to prove how evolution occurs. One of these men in particular played a significant role in Darwin’s theory, as we know it today.

Thomas Malthus was an economist from England who wrote an essay in 1798 titled, An Essay on the Principle of Population. Now, Malthus as mentioned was not a scientist. His essay was focused on humans and the growth of population. He argued that humans have a tendency to increase in their population size while the amount of food, space, and resources needed to sustain their population is limited. Because of this limit on food and water, populations are restricted in size based on the accessibility of these necessities. According to Malthus, he believed that unless individuals tried to contain the number of offspring they produced, and then the amount of food and water and other essential resources needed to survive would not be available. This theory, even though it was brought to Darwin’s attention through an economist, is what sparked Darwin to realize that species to reproduce more than the environment can handle, therefore leading to natural selection.

Evolution happens naturally, but through Darwin’s theory we are able to see it through a few main points. These points help us to see the process of evolution. There are several of these points that were made by Darwin that would not have been without the influence of Malthus. The first one is that all organisms have the potential of reproducing exponentially. Malthus only focused on humans, but he described in his essay that humans have the potential to produce as many offspring as possible; however, they will not all survive due to lack of essential resources. Humans or any species, can reproduce as many times as possible but only the offspring who can get enough water and food and shelter to survive will. The second point that is supported by Malthus is that resources are limited. Malthus pointed this out in his essay as well. It is hard to say whether or not Darwin already knew this before reading Malthus, but it is something that is supported in An Essay on the Principle of Population. As the population grows, the amount of food and water needed to sustain that population must grow too. On our planet, the amount of water and space we have is fixed; therefore, we are limited in the amount of resources we can provide for the population. If we continue to grow larger and larger as a population, eventually our resources will run out and those who are in better situations will be the ones to survive.

Malthus wrote his essay in the year 1798. This was eleven years prior to Charles Darwin’s birth. While it is possible for Darwin to have come up with these ideas on his own, it was not what occurred. He read the works of Malthus and then realized that it applied to his own hypothesis of evolution. Without these ideas of Malthus’s, Darwin’s theory of evolution would not have been able to develop. The ideas of limited essential resources are what create Darwin’s theory for competition to survive, or survival of the fittest. Those with the better traits will survive; the ones with the less desirable traits will not. These traits will ultimately die out.

The church was a large part of life during the days of Darwin and had a huge amount of influence among society at the time. It was believed by the general public that if ideas of evolution became more and more accepted across the country, then the future of the church would be unknown. Ultimately, it was thought that the church would fall about and society would revert into savage-like times. Once he decided to publish is book, On the Origin of Species, Darwin received a large amount of criticism from the general public but most of the scholars of the day received his book very well, leading to its acceptance as a scientific theory.

Sources:

"Charles Darwin." BBC News. BBC, n.d. Web. 11 Feb. 2015.

"Darwin and Malthus." PBS. PBS, 2001. Web. 12 Feb. 2015.

Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. "The            Development of Evolutionary Theory." Introduction to Physical Anthropology.            Belmont: Wadsworth, 2014. 25-47. Print.