Tuesday, March 31, 2015

Human Variation and Race

The cold is an environmental stress that we are all exposed to at different levels and at different lengths of time. This environmental stress has a negative impact on humans and their survival. In order for people who live in cold climates year round to have the best response to the climate, their evolution includes more compact bodies with more mass. In order to help keep the bodies temperate at a high enough degree, the blood vessels within the body begin to contract and become smaller, this helps with core temperatures. Because of such extreme cold temperatures, the body has to work harder to maintain a warm enough core temperature all while given the individual its normal function in order to survive.

People who live in this conditions constantly tend to drink alcohol to warm them. This is only a temporary solution and can cause a faster death from hypothermia. Alcohol is only a short-term solution because its effects wear off quickly. Culturally, individuals try to keep warm by wearing warmer clothes (things such as furs) and making sure their homes are insulated and are safe to have fires inside to keep them warm. Another type of adaptation that has been made is biological. Human bodies over time in cultures who are exposed to extreme cold have a fatty layer of insulation around their vital organs, they have an increased basal metabolic rate, and a long term change in their pattern of blood flow. The consumption of high calorie foods also helps.  IF individuals become too cold and frostbite or hypothermia sets in, these individuals loose fingers, toes, and limbs their ability to hunt and gather food, make warm clothing, and build fires would decrease as would their survival.

It is important for us to study human variation across environmental clines for several reasons. This type of information can help us learn how different humans adapted over time to different climates; it helps us to see why others might not have survived. When we study clines we can see over time how adaptations evolved and this information can help us when we study other adaptations.

We see different adaptations in different places across the world. Different skin tones, eye colors, fingerprints. While today our society focuses a lot on different races and how we look from one another, these differences were not made to separate us from one another. These differences were adaptations to our climates and environments based on where and how we lived. By looking at clines of weather we can see why and how these different “races” evolved so that they could survive and live in their specific climate.


Here are some photos of different adaptations in individuals living in cold climates:


Photos courtesy of: Britannica.com

Tuesday, March 24, 2015

Language Blog

For this week’s assignment, we were given two tasks. The first of the tasks was trying to communicate with others for 15 minutes without being able to use any language at all; this included both written language and sign language. At first when reading the instructions I felt that this would not be that difficult at all. Nodding and shaking of the head, pointing, smiling, these were all ways to communicate without words and a lot of communication is done that way. Well, I was surprised that it was not as simple or easy as I had thought. It made me realize that much of the way individuals communicate is through vocalization.

One thing that I noticed from this was that my wife and her sister, the other two individuals helping me with this experiment began to use their own hands and facial expressions to communicate and less of their words. They would point to something instead of saying it and when they did talk to me they used very short sentences or only said one or two words. Just as not speaking was hard, they had a difficult time trying to understand my needs through my new communication.

In terms of controlling the conversation, by far the other two had all the control. They were able to begin the conversation, determine where it went, change the topic, and ask questions. I was not able to do any of those things and this also made me realize how much of a one-sided conversation we had going on! If is very easy to be left out in this situation from the conversation. Because I could only use my hands really to talk for me, I could not jump in and talk over one of them. I couldn’t interject my real thoughts because I was not able to express them without words. I could not imagine how my life would be different if I was not able to speak. In terms of who had power of the situation, I would have to say hands down my wife and sister-in-law. They controlled where it started and where it ended.

It seems obvious now after conducting the experiment that the culture whose people use spoken language would have a much better way of communicating ideas with their own population. There is just so much more that you can express and communicate with spoken word than you can do with hand signals, facial expressions, and body language. I think the society that uses verbal expressions might look down upon the one who does not. It takes time and attention to understand what the other person is trying to communicate. I don’t know if certain cultures would make that effort. An example of this, which can be seen today, is our “normal” society and the deaf community. There are a lot of individuals who are unable to hear and speak in our society today and they communicate through body language and sign language. But, not everyone in the speaking community understands sign language or tries to understand it. And, because there are fewer members of that community, us “speakers” do not have as many ways to communicate with them as they do with us.

The second part of the assignment was to communicate with words but without the use of hand signals, verbal intonations, and body movements. I must admit that I thought this would be easier than the first part of the assignment, and I was partially right. It was definitely much easier to communicate with the others because I could say what I was thinking or what I wanted however, I really noticed how much individuals rely on intonations and how much individuals use their hands when they talk. These two things were much more difficult to not use than I had originally thought.

When we speak the inflections that we use in our voices help us communicate. They help us express anger, happiness, displeasure and other emotions. I do not think my partners had difficulty understanding what I wanted because I was verbally telling them, but they were not sure if I was upset or not, joking or not, or if something was the matter.

Body language is a large part of our communication, even though we use verbal communication as well. The position someone is sitting in, how they have their hands or what they are doing with their hands, their eyes and facial expressions can tell what the person is really thinking. We hear the words and see the body, giving us a complete understanding by putting together both forms of communication.


Successful reading of body language is an essential skill to have. We use our bodies to show pleasure and displeasure, frustration, and every other emotion. We can say something in one tone but reach out for a comforting hug. Or make a mad face to emphasize what we are saying. Without being able to read someone’s body language we might not really know what they mean or misunderstand what it is they are trying to say. An example of where this comes into effect today is email. It is hard and we cannot always tell the tone of which the words are written. When someone talks we can hear inflections and tone of voice and we can see their body language to tell if they are happy or mad or annoyed. In an email we do not have all these other aspects to assess. All we have is the written words, which can be subject to interpretation. Not every situation do we need these other languages but over all I believe they prove to be more helpful than not.

Tuesday, March 10, 2015

The Piltdown Man

The Piltdown hoax deals with a discovery and a mysterious person. It sounds like a mystery you might hear on a television show, but this real life mystery is real and happened in England in the early 1900s.

Discovered in southern England near the town of Piltdown, a man working outside discovered an odd piece of a skull. After the discovery the man gave the piece to a local amateur archaeologist, Charles Dawson. Dawson realized that this skull was very primitive looking and might be something important. He took the skull to London’s Natural History Museum where he brought the bone to Sir Arthur Smith Woodward. Now, it is important to remember that no early man had ever been discovered in England before this time.

A few years later and after a few more discoveries of bones, Dawson and Woodward presented “the earliest Englishman” in 1912. These human remains were said to be the clue in human evolution everyone was waiting for. They seemed to show the evolution from apes to humans and it proved Charles Darwin’s theory. This find though did cause some controversy among scientists. Not everyone could agree on how human or how ape-like the remains were. And, not everyone agreed that the skull and jaw, found in two separate discoveries, belonged to each other. Not too long after, a tooth was discovered which seemed to better link the two previous finds together. And, in 1917, Dawson found Piltdown Man Two.

But, with two Piltdown Men, scientists were still not all on the same page. And in 1953 it was determined that Piltdown man was a hoax. It seems that the fake bones came from London’s Natural History Museum. The skull bone was stained to look older than it was. A file was used on the teeth to change their appearance, and the skull and jawbones were from two different time periods. Even with the discovery, the scientific community was unsure, and still is unsure, who planted these bones.

Scientists are always looking out for new evidence and want to prove their own theories. When these bones were discovered, scientists in England wanted there to be early man from England. At the time, discoveries had been made in other parts of Europe, except England. After these bones were brought to the museum, scientists were eager to prove that primitive life had existed there. This want and need might have played into the oversight of these bones. Lack of technologies at the time is also another reason why these bones might have been believed to be real for a while. However, when discoveries are made and believed to be real and then proven wrong, it impacts the scientific community and puts doubt in people’s minds. It puts a sense of mistrust into science. A lot of time, theories are things that have to be proven over time. When scientists come out and have verified these fossils that are then proven to be fake, it makes their other contributions to science questionable. Another theory is that due to intense competition, scientists wanted to prove that early man existed there and each one of them wanted to be the one to prove it. This motivation might have been another cause for the “oversights”.

The fact that science was also used to prove the bones were faux is also a positive aspect of the scientific process. The same process that was used to say these bones were legitimate was used to prove they were not. Scientists, with further investigation, could see file marks on the teeth with a magnifying glass. If they had been examined closer in the beginning they would have been seen earlier. The markings on the bones and the coloration, which was caused from boiling the bones and then stained, would have also been determined by further examination.


I believe that without personal motivation and feuds, the human factor can be removed from science. Individuals at this time and many other times, want to prove their theories or make a big discovery to be remembered throughout time. If these wants and personal achievements were removed, I feel that less errors and frauds would exist. This is just one example of a situation were people should not take things at face value. Just like the internet, there are a lot of people who can make claims and have “evidence” to prove it, but without verified sources these claims can be just as faux as the Piltdown Man. It is everyone’s responsibility to investigate before believe everything they read.

Tuesday, March 3, 2015

Comparative Primate Blog Post

For this week’s assignment I am focusing on locomotor patterns of the five primates.

Lemurs:
a.     Lemurs are from the island of Madagascar as well as a few near by islands off the coast of Africa. They are not found anywhere else in the world. They live in trees as well as on the ground, but are typically found in the trees. These islands have a forest type of environment where these animals are found.
b.     Lemurs have two arms, two legs, and a very long tail. They walk and run using all four limbs on the ground. Unlike other primates they do not grip with their tails or hang from trees with their tails. They do stand on their legs for balance.
c.      The lemur has been on the island of Madagascar for thousands of years. On this island, they have survived by living in trees. They use their limbs to climb trees, eat fruit and leaves, and lay out on branches These animals are small, so living up high protects them from other predators on the ground. Their tail is used for balance. Their environment has allowed for them to live comfortably without too many predators; they are able to live both on the ground and in trees. Their arms and legs give them the ability to walk on the ground as well as climb in trees to sleep and eat.
d.      


Spider Monkeys:

a.     Spider Monkeys live in tropical environments in both Central and South America. They are found high up in the trees where they swing from branch to branch looking for food and sleeping.
b.     Spider Monkeys, just like lemurs, have two arms, two legs, and a long tail. However, unlike the lemur, spider monkeys use their tails to swing from tree branch to tree branch and to grasp things. They walk on all four limbs and their tail serves as balance when not being used to grasp something.
c.      These monkeys live high up in the branches of trees in a forest setting and are small. They use their long tails to swing from branch to branch, a way to move around the canopy across trees without having to go down to the forest floor. They also use their other limbs to walk along branches to gain access to fruit and other food.
d.      
Photo Credit:  http://www.srl.caltech.edu/personnel/krubal/rainforest/Edit560s6/www/animals/spidermonkeypage.html


Baboon:

a.     Baboons can be found in Africa. There are multiple species of baboons and all of them live in central Africa. Most of them live in the savanna, rather than in the forest such as the other animals we have looked at, but some species do live in the forest. They prefer to live in tall trees or near cliffs.
b.     Like the other primates, baboons also have two arms, two legs, and a long tail. These animals are very large, some of the bigger of the primates. They do not have a tail that grips, like the spider monkey, and typically do not climb trees but they can. They spend most of their time on the ground walking on all four legs.
c.      It seems that because baboons are hunted, they have to find a way to get away from predators. With the help of their tails, baboons are able to climb trees to get away from danger. They live in the savanna where there are lots of other animals that are just as bigger if not bigger than they are. They have adapted to use their tail for climbing trees to survive.
d.      
 





Gibbons:

a.     Gibbons live in the thick forests of Asia in countries such as Laos, Cambodia, and China. They live high up in the trees of the forest.
b.     Just like the other primates we have discussed, gibbons have a long tail, two arms and two legs. They live high up in the trees, rarely coming down to the ground. When they are on the ground, they walk on their back legs with their arms up in the arm to help with their balance. They have a special type of movement, known as brachiating; this allows them to swing among the branches because their fingers hook the limbs instead of grabbing them. When they are on the ground, they walk more like humans than other primates.
c.      Because these animals live mainly high up in the trees, without coming down to the ground, they need to be able to get from tree to tree, limb to limb. Their adapted motion, brachiating, allows them to do this quickly and swiftly. This allows them to swing out far as well to grab fruits that are way out on the end of limbs. This gives them the ability to gain food other animals might not be able to reach.
d.      
Chimpanzee:

a.     Our closest living relatives, chimpanzees live in the African rainforests, the woodlands, and grasslands. They prefer to live however in the rainforest.
b.     Chimpanzees are known as knuckle walkers, meaning, they walk on all four limbs but they walk on their front knuckles. However, they walk upright at short distances. They do also live in trees where they use their long limbs to swing from branches. One difference in these primates from others is their lack of a tail.
c.      Chimpanzees use their limbs for other uses than the previously discussed primates. They are able to use their fingers and thumbs to dig and grab things differently than the others. They are able to eat a wide array of food and the use of their hands helps them to do that. They do obtain most of their food from the trees, fruit and leaves. They are able to climb trees using both their arms and legs and their fingers to grab branches.  
d.      

Summary:

All of the five animals discussed above are primates. They have similar characteristics and features, however, they all have differences, which allow them to live and sustain their populations in different environments. Not all of them have tails, and the ones that do use them for different things. Some are able to swing from branch to branch with them while others use them to help with their balance. Gibbons use their fingers to swing from branches instead of grasping like chimpanzees.  These animals live in different places, some in Asia, most in Africa. They have learned to adapt to their environments through their motion. Depending on the heights and distances of trees, some primates rarely walk on the ground, therefore they use their long arms and legs to crawl or swing from branch to branch. Others use their legs and arms to walk on the ground. Animals must adapt to survive. We have been studying and learning all about this and these different characteristics prove that. All five are primates, and all five live in different settings and environments. Each one uses their arms, legs, and tail for different uses all for a means of survival, whether it is to get food or to move from predators.



Works Cited:


http://animals.nationalgeographic.com/animals/mammals/chimpanzee/

http://animals.nationalgeographic.com/animals/mammals/gibbon/?source=A-to-Z


http://animals.nationalgeographic.com/animals/mammals/spider-monkey/?source=A-to-Z




http://www.janegoodall.org/chimpanzees/fast-facts

http://www.kidsplanet.org/factsheets/chimpanzee.html

http://www.lpzoo.org/animals/factsheet/white-cheeked-gibbon

http://www.monkeyworlds.com/baboon/



http://wwf.panda.org/about_our_earth/species/profiles/mammals/black_spider_monkey/



Thursday, February 26, 2015

Analogy/Homology Blog Post

Homologus traits:

For my species that posses homologus traits I chose whales and humans and their arms and fins. The bones in both the human hand and arm are similar to the bones that are in the fin of a whale. We humans have five fingers and even though we cannot see them, whales have five “finger” bones as well. In addition to those finger bones, both whales and humans have a humerus, a radius, and an ulna. Humans use their hands and fingers to help us function on dry land. Whales are in the water so they do not need fingers like humans do. Their fins function for their environment; if they had fingers underwater it would slow them down. The common ancestor between these two species would be the first tetrapod, which scientists believe lived 350 million years ago. It is believed that in addition to humans and whales, lizards and birds are also descendants of this one common ancestor.












Photo Courtesy of: World Wildlife Organization


 
 Photo Courtesy of Pace University



Analogous traits:

Two different species that possess analogous traits are dolphins and sharks. Both are animals who live in the ocean and have similar features, such as fins, body shape, however many of their features are analogous and not homologus. They both have fins and swim instead of live on land. One of their similarities to the naked eye is their shape. Both animals have a similar shape, however sharks do not have bones rather, they have cartilage. Dolphins on the other hand have bones. It would seem that both animals would have similar skeletons not only because they look similar but, they share the same environment.  It is possible that back in time somewhere these two animals did share a common ancestor. However, dolphins are mammals and sharks are not. This is a major difference between the two species.  Since they are not of the same family we know that the traits have evolved over long periods of time.
 

Photo Courtesy of: National Geographic Your Voice
 

Photo Courtesy of: BBC



Sources used:


http://evolution.berkeley.edu/evolibrary/article/0_0_answer=b/similarity_hs_09

http://www.pace.edu/human-resources/



http://www.worldwildlife.org/species/whale

Thursday, February 19, 2015

Week 2: Protein Synthesis

Here is my DNA code for this week's blog post:


CGATTACACCCTGTCAGATCTTAAGTGAACATCTATCATTGC

Thursday, February 12, 2015

Historical Influences on Darwin

Charles Darwin and his theory of Natural Selection is still something that we use in science today. As we have learned, Darwin used his hypothesis to prove how evolution happens. Through his own observation and thoughts as well as influence from several other men, including his grandfather, Charles Darwin was able to provide sufficient evidence to prove how evolution occurs. One of these men in particular played a significant role in Darwin’s theory, as we know it today.

Thomas Malthus was an economist from England who wrote an essay in 1798 titled, An Essay on the Principle of Population. Now, Malthus as mentioned was not a scientist. His essay was focused on humans and the growth of population. He argued that humans have a tendency to increase in their population size while the amount of food, space, and resources needed to sustain their population is limited. Because of this limit on food and water, populations are restricted in size based on the accessibility of these necessities. According to Malthus, he believed that unless individuals tried to contain the number of offspring they produced, and then the amount of food and water and other essential resources needed to survive would not be available. This theory, even though it was brought to Darwin’s attention through an economist, is what sparked Darwin to realize that species to reproduce more than the environment can handle, therefore leading to natural selection.

Evolution happens naturally, but through Darwin’s theory we are able to see it through a few main points. These points help us to see the process of evolution. There are several of these points that were made by Darwin that would not have been without the influence of Malthus. The first one is that all organisms have the potential of reproducing exponentially. Malthus only focused on humans, but he described in his essay that humans have the potential to produce as many offspring as possible; however, they will not all survive due to lack of essential resources. Humans or any species, can reproduce as many times as possible but only the offspring who can get enough water and food and shelter to survive will. The second point that is supported by Malthus is that resources are limited. Malthus pointed this out in his essay as well. It is hard to say whether or not Darwin already knew this before reading Malthus, but it is something that is supported in An Essay on the Principle of Population. As the population grows, the amount of food and water needed to sustain that population must grow too. On our planet, the amount of water and space we have is fixed; therefore, we are limited in the amount of resources we can provide for the population. If we continue to grow larger and larger as a population, eventually our resources will run out and those who are in better situations will be the ones to survive.

Malthus wrote his essay in the year 1798. This was eleven years prior to Charles Darwin’s birth. While it is possible for Darwin to have come up with these ideas on his own, it was not what occurred. He read the works of Malthus and then realized that it applied to his own hypothesis of evolution. Without these ideas of Malthus’s, Darwin’s theory of evolution would not have been able to develop. The ideas of limited essential resources are what create Darwin’s theory for competition to survive, or survival of the fittest. Those with the better traits will survive; the ones with the less desirable traits will not. These traits will ultimately die out.

The church was a large part of life during the days of Darwin and had a huge amount of influence among society at the time. It was believed by the general public that if ideas of evolution became more and more accepted across the country, then the future of the church would be unknown. Ultimately, it was thought that the church would fall about and society would revert into savage-like times. Once he decided to publish is book, On the Origin of Species, Darwin received a large amount of criticism from the general public but most of the scholars of the day received his book very well, leading to its acceptance as a scientific theory.

Sources:

"Charles Darwin." BBC News. BBC, n.d. Web. 11 Feb. 2015.

"Darwin and Malthus." PBS. PBS, 2001. Web. 12 Feb. 2015.


Jurmain, Robert, Lynn Kilgore, Wenda Trevathan, and Russell L. Ciochon. "The            Development of Evolutionary Theory." Introduction to Physical Anthropology.            Belmont: Wadsworth, 2014. 25-47. Print.